GARY GRIMES, FASTEST
VICE PRESIDENT ON EARTH,
HEADS UP SunCLONETM
|
SunCLONE ONE bio-
robotic mid-frame
|
Gary Grimes, Southern Area Vice President
for Sales, has been promoted to President of Sun's newest subsidiary, SunCLONE.
It was extremely important to SMI that we select the right person to lead
SunCLONE. We needed a fast-moving leader to master this dynamic market.
Gary Grimes was selected because, after careful examination, we have determined
that Gary is not only the fastest VP at Sun but also on planet Earth.
Gary is the only VP at Sun to have a racing license and could have been
a world class driver if he had chosen to pursue a racing career. Gary
has driven and owns some of the fastest cars ever produced and we know
that the stress of a very fast-moving market would not be a problem for
him. We needed someone who would not be distracted by some of the
religious, ethical, privacy, and consumer issues that will undoubtedly
crop up with this announcement. With his laser-like focus on execution,
we feel that Gary is the right man for this job.
Read the complete announcement
e-mail.
Visit the live Web
Cam.
Building the SunCLONE
ONE
For thousands of years, philosophers have
pondered the central question of our existence: Are we simply the product
of our biological inheritance or do the experiences of our lifetime shape
who we are? Today, with the complete mapping of the human genome and the
cloning of Dolly, this question has also captured the popular imagination.
People from all walks of life -- insurance agents, hot dog vendors, shoe
salesmen, water-cooler louts, ignorant drunks and even fans of Temptation
Island and AM talk show hosts -- are debating genes vs. learning, DNA
vs. experience, Darwin vs. Skinner. In short, Nature vs. Nurture.
|
Dolly (on right) with
unnamed lamb |
Throughout history the Nature vs. Nurture
debate has occupied and stumped brilliant scholars and crackpots
alike. It took the incendiary brilliance of the super-geniuses at Sun's
SundEnPjMsF subsidiary to realize that this question
deserved not an answer, but a rebuttal. Nature and Nurture are two sides
of the same coin and, when trying to capture the entire human, both sides
must be considered.
It was this philosophical, metaphysical
breakthrough which made the SunCLONE ONE possible. By combining both Nature,
in the form of JDNA Enterprise Java Beans (EJBs), and Nurture, in the form
of JMRI brain scans, the SunCLONE ONE achieves a holistic synthesis, exactly
replicating its human base unit.
JDNA - Nature and Java Together For The First
Time
|
Human Chromosome Number
3, showing the sales rep gene |
The making of a SunCLONE ONE starts with
the painless extraction of the 23 chromosome pairs which comprise the complete
DNA code of the human base unit. This DNA is then amplified using the Nobel
Prize-winning Polymerase Chain Reaction (PCR) process. After amplification,
the human base unit's DNA is passed to a nucleotide sequencing machine
which reads the code's base pairs. This nucleotide sequence is then stored
in a central 2435-dimensional data warehouse which is used for cutting
edge scientific and marketing research (see our
Privacy Policy).
|
DNA extraction
via micro-needle |
DNA for the SunCLONE ONE is extracted using
a micro-needle probe no larger than 1/42 the width of a human hair. The
micro-needle pierces the donor cell's nucleus and gently sucks out its
chromosomes. Previously, this delicate procedure could only be performed
by highly-trained technicians in a clean-room environment. But in an amazing
display of eating our own dog food, the SunCLONE ONE Home DNA Extraction
kit uses robotic technology developed for the SunCLONE ONE product to allow
easy and painless DNA sucking in the privacy of your own home.
import javax.jdna.Genome;
public class GaryGrimes extends Genome {
Genome genes = new Genome(
"CGTACCGCGCTAATCGTTTCTGAAGCTCGA\
CTGTCTGATGCTCGTAAAGCCGATCTACTAG\
CCGCTAGATAATAGCTAGAAGTTGCAGCTGC\
CGTAAACCATGCTGGTAAGTAGCTAGCATGG\
CTCTCGATAGATCDAVESTINKSACAGTCAA\
CGCTGAATAACAGCATAGCATATTTCACGTA...
|
JDNA Source Code
Using jdnac, Sun's patented DNA-to-Java
compiler, the organic DNA is converted into Java source code. The resulting
Java class files use the JDNA Java extension to map the function of human
biological processes onto the bio-robotic SunCLONE ONE device.
JDNA EJBs, which were developed using the
highly successful Java Community Process, are part of the Java 2 Biological
Edition (J2BE). Each SunCLONE ONE includes an iPlanet J2BE application server
which executes in a massively parallel fashion on the 340x1036 MAJC processors
comprising the SunCLONE ONE midframe. This amazing assemblage exactly
duplicates the human base unit's biologic make-up, without any of the inconvenient
drawbacks of biological instantiation: hunger, thirst, pain, and so forth.
JMRI - Yes, We Can Read Your Mind
Duplicating the human base unit's DNA is relatively
straightforward, but how could we possibly capture the lifetime of learning
that makes even genetically identical twins unique human beings? One way
would be to exactly duplicate the human base unit's life, exposing the
SunCLONE ONE to the same experiences and formative factors. While that
might succeed, it's way too much work and it lacks the instant gratification
so important in today's fast-changing markets. Instead, we simply "rip"
those experiences from the human, using a process analogous to "ripping"
a music CD into an MP3 file.
|
Actual scan of Gary Grimes's
brain, not actual size. |
JMRI brain scans enable this ripping process.
Extremely high-detail MRI scans of the human's brain allow us to exactly
map the web of neural connections which encode his personality. In less
than 0.4 seconds, an entire lifetime of hopes, dreams, loves and disappointments
are converted into a simple and easily manipulated Java source file using
the JMRI extention. This JMRI code, when combined with the appropriate
JDNA EJBs and SunCLONE ONE's distributed, massively parallel MAJC-based
architecture, forms the "brain" of the SunCLONE ONE.
Mass Market Cloning Today!
|
Bulky MRI Dinosaur |
Traditional MRI scanners are large, uncomfortable
and expensive. Since the SunCLONE ONE is intended to be a mass market,
consumer product, SundEnPjMsF was forced to find an innovative, new way
of capturing the needed brain scans. Working through the Java Community
Process, Sun and major MRI and point-of-sales device manufacturers were
able to miniaturize the traditional MRI scanner and incorporate it into
a common checkout line cash register.
|
JMRI-equipped
cash register |
Today, over 93% of all stores in the United
States are equipped with these sophisticated devices. Every time you complete
a credit card purchase at one of these registers, a new, up-to-date scan
of your brain is transmitted to Sun's central data warehouse (see our
Privacy Policy). You don't
have to do anything else. In fact, chances are your brain scan is already
on file with Sun (see our
Privacy Policy). By continually updating your SunCLONE ONE brain profile,
we ensure that your SunCLONE ONE is equipped with the most complete and
accurate representation of your personality possible.
Putting It All Together
|
Actual photo-micrograph
of
Gary Grimes's DNA |
Duplicating the mind of the human base unit
is only half the problem. We must also build a suitable body. While early
beta units used a human body, for the production SunCLONE ONE we have chosen
a bio-robotic technology which offers many advantages over the hundreds
of pounds of meat typically used to house a human intellect. For example,
your SunCLONE ONE requires neither food nor rest and is totally exempt from
most labor and human rights laws. The SunCLONE ONE's body uses the latest
in self-organizing criticality, atto-technology and molecular self-assembly
to create the perfect merger of human creativity and relentless machine
perfection (see our Disclaimer).
With Nature and Nurture housed in a perfect,
nigh-invulnerable body, the SunCLONE ONE is the perfect answer to many
questions which man was not meant to ask!
Related stories
|